{"lab": {"status": "current", "uuid": "828cd4fe-ebb0-4b36-a94a-d2e3a36cc989", "display_title": "4DN DCIC, HMS", "@type": ["Lab", "Item"], "@id": "/labs/4dn-dcic-lab/", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.828cd4fe-ebb0-4b36-a94a-d2e3a36cc989"]}}, "sop": {"uuid": "5e017160-ad8b-49c1-a129-ccbd29966b6d", "status": "released", "@id": "/protocols/5e017160-ad8b-49c1-a129-ccbd29966b6d/", "display_title": "4DN Standard 2-stage Repli-seq protocol", "date_created": "2017-11-17T17:51:41.239372+00:00", "protocol_type": "Experimental protocol", "title": "4DN Standard 2-stage Repli-seq protocol", "attachment": {"href": "@@download/attachment/4DN_E_L_Repliseq_SOP_171206.pdf", "size": 213854, "type": "application/pdf", "md5sum": "c50478d0b9605c2b8b2f8de7e61ff70a", "blob_id": "be9b662e-46b8-46d9-9fe9-30cb0c3a1b06", "download": "4DN_E_L_Repliseq_SOP_171206.pdf"}, "@type": ["Protocol", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "award": {"status": "current", "@id": "/awards/1U01CA200059-01/", "uuid": "b0b9c607-f8b4-4f02-93f4-9895b461334b", "display_title": "4D NUCLEOME NETWORK DATA COORDINATION AND INTEGRATION CENTER - PHASE I", "@type": ["Award", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "title": "2-stage Repli-seq", "status": "released", "other_tags": ["1D"], "date_created": "2019-03-28T18:12:02.940353+00:00", "submitted_by": {"error": "no view permissions"}, "last_modified": {"modified_by": {"error": "no view permissions"}, "date_modified": "2024-07-26T17:22:09.570600+00:00"}, "raw_file_types": "Reads (fastq) provided by lab", "reference_pubs": [{"display_title": "Marchal C et al. (2018) PMID:29599440", "journal": "Nature protocols", "short_attribution": "Marchal C et al. (2018)", "@id": "/publications/e3427217-1675-433a-b844-f40d8ec7d2b5/", "@type": ["Publication", "Item"], "status": "current", "authors": ["Marchal C", "Sasaki T", "Vera D", "Wilson K", "Sima J", "Rivera-Mulia JC", "Trevilla-Garcia C", "Nogues C", "Nafie E", "Gilbert DM"], "uuid": "e3427217-1675-433a-b844-f40d8ec7d2b5", "date_published": "2018-03-29", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "schema_version": "1", "static_content": [{"content": {"filetype": "md", "title": "Overview", "name": "resources.data-analysis.repli-seq-processing-pipeline.overview", "@id": "/static-sections/5dee2016-0ea2-4862-a037-b18ded1302cd/", "@type": ["StaticSection", "UserContent", "Item"], "content_as_html": "

The 4DN Repli-seq data processing pipeline includes read clipping, alignment, filtering, and aggregation. Downstream normalization, smoothing and replicate merging steps will be implemented in the near future.

\n
\n\n\n\n
", "status": "released", "display_title": "Overview", "content": "The 4DN Repli-seq data processing pipeline includes read clipping, alignment, filtering, and aggregation. Downstream normalization, smoothing and replicate merging steps will be implemented in the near future.\n\n
\n\n\n\n
\n ", "lab": {"status": "current", "@id": "/labs/4dn-dcic-lab/", "display_title": "4DN DCIC, HMS", "uuid": "828cd4fe-ebb0-4b36-a94a-d2e3a36cc989", "@type": ["Lab", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.828cd4fe-ebb0-4b36-a94a-d2e3a36cc989"]}}, "award": {"@id": "/awards/1U01CA200059-01/", "@type": ["Award", "Item"], "uuid": "b0b9c607-f8b4-4f02-93f4-9895b461334b", "status": "current", "display_title": "4D NUCLEOME NETWORK DATA COORDINATION AND INTEGRATION CENTER - PHASE I", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "options": {"filetype": "md", "collapsible": false, "default_open": true, "convert_ext_links": true}, "uuid": "5dee2016-0ea2-4862-a037-b18ded1302cd", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.owner", "userid.986b362f-4eb6-4a9c-8173-3ab267307e3a"]}}, "location": "tab:data_processing"}, {"content": {"filetype": "rst", "title": "Read Clipping", "name": "resources.data-analysis.repli-seq-processing-pipeline.clip", "@id": "/static-sections/12bf2793-6712-4e03-aeef-a67a8d613597/", "@type": ["StaticSection", "UserContent", "Item"], "content_as_html": "

Adaptor sequences are clipped from repli-seq reads using cutadapt version 1.14. Specifically, we run:

\ncutadapt -q 0 -O 1 -m 0 -a <adaptor> <fastq>\n

AGATCGGAAGAGCACACGTCTG is used as adaptor sequence.

", "status": "released", "display_title": "Read Clipping", "content": "Adaptor sequences are clipped from repli-seq reads using ``cutadapt`` version 1.14. Specifically, we run: ::\n\n cutadapt -q 0 -O 1 -m 0 -a \n\n* The ``-q 0`` is used to turn off low-quality base removal before adapter searching.\n* The ``-O 1`` sets the minimum required overlap length between read end and adaptor to be 1 (default is 3), in case the adaptor sequence partially overlaps with the read rather than being contained in a read.\n* The ``-m 0`` means that empty reads are kept and will appear in the output.\n\n**AGATCGGAAGAGCACACGTCTG** is used as adaptor sequence.", "lab": {"status": "current", "@id": "/labs/4dn-dcic-lab/", "display_title": "4DN DCIC, HMS", "uuid": "828cd4fe-ebb0-4b36-a94a-d2e3a36cc989", "@type": ["Lab", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.828cd4fe-ebb0-4b36-a94a-d2e3a36cc989"]}}, "award": {"@id": "/awards/1U01CA200059-01/", "@type": ["Award", "Item"], "uuid": "b0b9c607-f8b4-4f02-93f4-9895b461334b", "status": "current", "display_title": "4D NUCLEOME NETWORK DATA COORDINATION AND INTEGRATION CENTER - PHASE I", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "options": {"filetype": "rst", "collapsible": false, "default_open": true, "convert_ext_links": true}, "uuid": "12bf2793-6712-4e03-aeef-a67a8d613597", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.owner", "userid.986b362f-4eb6-4a9c-8173-3ab267307e3a"]}}, "location": "tab:data_processing"}, {"content": {"filetype": "rst", "title": "Alignment", "name": "resources.data-analysis.repli-seq-processing-pipeline.alignment", "@id": "/static-sections/1d6fbeb6-2e45-41f6-a064-f078ab592a97/", "@type": ["StaticSection", "UserContent", "Item"], "content_as_html": "

Clipped repli-seq reads are mapped to the GRCh38 (human) or mm10 (mouse) reference genome using bwa version 0.7.15. Specifically, we run bwa mem with default options:

\nbwa mem <genome_index> <fastq1> <fastq2>\n
", "status": "released", "display_title": "Alignment", "content": "Clipped repli-seq reads are mapped to the `GRCh38 `_ (human) or `mm10 `_ (mouse) reference genome using `bwa` version 0.7.15. Specifically, we run `bwa mem` with default options: ::\n\n bwa mem \n", "lab": {"status": "current", "@id": "/labs/4dn-dcic-lab/", "display_title": "4DN DCIC, HMS", "uuid": "828cd4fe-ebb0-4b36-a94a-d2e3a36cc989", "@type": ["Lab", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.828cd4fe-ebb0-4b36-a94a-d2e3a36cc989"]}}, "award": {"@id": "/awards/1U01CA200059-01/", "@type": ["Award", "Item"], "uuid": "b0b9c607-f8b4-4f02-93f4-9895b461334b", "status": "current", "display_title": "4D NUCLEOME NETWORK DATA COORDINATION AND INTEGRATION CENTER - PHASE I", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "options": {"filetype": "rst", "collapsible": false, "default_open": true, "convert_ext_links": true}, "uuid": "1d6fbeb6-2e45-41f6-a064-f078ab592a97", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.owner", "userid.986b362f-4eb6-4a9c-8173-3ab267307e3a"]}}, "location": "tab:data_processing"}, {"content": {"filetype": "md", "title": "Filtering", "name": "resources.data-analysis.repli-seq-processing-pipeline.filter", "@id": "/static-sections/783638cb-c81a-410f-bb42-a55222d6f2aa/", "@type": ["StaticSection", "UserContent", "Item"], "content_as_html": "

For filtering valid Repli-seq alignments, we use samtools. \nSpecifically, the filtering workflow consists of the following\n steps:

\n
    \n
  • MAPQ filtering: samtools view command with -q 20 was used to skip alignments with MAPQ smaller than 20.
    • \n
  • Sorting: samtools sort command was used to sort alignments by genomic coordinates.
    • \n
  • Removal of PCR duplicates: samtools rmdup command was used to remove duplicate alignments.
    • \n
", "status": "released", "display_title": "Filtering", "content": "For filtering valid Repli-seq alignments, we use `samtools`. \nSpecifically, the filtering workflow consists of the following\n steps:\n\n* **MAPQ filtering**: `samtools view` command with `-q 20` was used to skip alignments with MAPQ smaller than 20.\n* **Sorting**: `samtools sort` command was used to sort alignments by genomic coordinates.\n* **Removal of PCR duplicates**: `samtools rmdup` command was used to remove duplicate alignments.\n", "lab": {"status": "current", "@id": "/labs/4dn-dcic-lab/", "display_title": "4DN DCIC, HMS", "uuid": "828cd4fe-ebb0-4b36-a94a-d2e3a36cc989", "@type": ["Lab", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.828cd4fe-ebb0-4b36-a94a-d2e3a36cc989"]}}, "award": {"@id": "/awards/1U01CA200059-01/", "@type": ["Award", "Item"], "uuid": "b0b9c607-f8b4-4f02-93f4-9895b461334b", "status": "current", "display_title": "4D NUCLEOME NETWORK DATA COORDINATION AND INTEGRATION CENTER - PHASE I", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "options": {"filetype": "md", "collapsible": false, "default_open": true}, "uuid": "783638cb-c81a-410f-bb42-a55222d6f2aa", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.owner", "userid.986b362f-4eb6-4a9c-8173-3ab267307e3a"]}}, "location": "tab:data_processing"}, {"content": {"filetype": "rst", "title": "Binning and Aggregation", "name": "resources.data-analysis.repli-seq-processing-pipeline.counting", "@id": "/static-sections/7a2e5772-c31c-4f8a-95fc-0c4aeebdcf9e/", "@type": ["StaticSection", "UserContent", "Item"], "content_as_html": "

Filtered reads were aggregated for each 5kb window using bedtools coverage. Specifically, the following command was used:

\nbedtools coverage -counts -sorted -a <BINFILE> -b <INPUT_BAM>\n

Output is provided in both gzipped bedgraph and bigwig formats and can be viewed using HiGlass.

As of v16.1, the pipeline output includes a raw counts file in addition to the default scaled counts (RPKM).

", "status": "released", "display_title": "Binning and Aggregation", "content": "Filtered reads were aggregated for each 5kb window using ``bedtools coverage``. Specifically, the following command was used: ::\n\n bedtools coverage -counts -sorted -a -b \n\nOutput is provided in both gzipped ``bedgraph`` and ``bigwig`` formats and can be viewed using HiGlass.\n\nAs of v16.1, the pipeline output includes a raw counts file in addition to the default scaled counts (RPKM).\n", "lab": {"status": "current", "@id": "/labs/4dn-dcic-lab/", "display_title": "4DN DCIC, HMS", "uuid": "828cd4fe-ebb0-4b36-a94a-d2e3a36cc989", "@type": ["Lab", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.828cd4fe-ebb0-4b36-a94a-d2e3a36cc989"]}}, "award": {"@id": "/awards/1U01CA200059-01/", "@type": ["Award", "Item"], "uuid": "b0b9c607-f8b4-4f02-93f4-9895b461334b", "status": "current", "display_title": "4D NUCLEOME NETWORK DATA COORDINATION AND INTEGRATION CENTER - PHASE I", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "options": {"filetype": "rst", "collapsible": false, "default_open": true, "convert_ext_links": true}, "uuid": "7a2e5772-c31c-4f8a-95fc-0c4aeebdcf9e", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.owner", "userid.986b362f-4eb6-4a9c-8173-3ab267307e3a"]}}, "location": "tab:data_processing"}, {"content": {"filetype": "html", "name": "repliseq-processed-files", "@id": "/static-sections/f963ca27-1f3a-4f88-a9d9-96d1dcdb4d82/", "@type": ["StaticSection", "UserContent", "Item"], "content_as_html": "
Below is a description of the file formats available on the portal as outputs of the data processing pipeline.\n

\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n
File TypeFile FormatDescription
Alignment.bam Filtered alignments of raw reads to the appropriate reference are available in .bam format. These are generated separately for each replicate experiment in an experiment set.
Read Countsbedgraph (.bg)Contains read counts for each 5kb window after filtering. Replicate experiments are processed separately. These will often have 2 associated files with them - a bedgraph index (.bedGraph.gz.px2) and a bigwig (.bw) file. The bigwig file can be visualized as a 1D track in HiGlass.
", "status": "released", "display_title": "repliseq-processed-files", "content": "Below is a description of the file formats available on the portal as outputs of the data processing pipeline.\n

\n\n\n\n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n \n
File TypeFile FormatDescription
Alignment.bam Filtered alignments of raw reads to the appropriate reference are available in .bam format. These are generated separately for each replicate experiment in an experiment set.
Read Countsbedgraph (.bg)Contains read counts for each 5kb window after filtering. Replicate experiments are processed separately. These will often have 2 associated files with them - a bedgraph index (.bedGraph.gz.px2) and a bigwig (.bw) file. The bigwig file can be visualized as a 1D track in HiGlass.
", "lab": {"status": "current", "@id": "/labs/4dn-dcic-lab/", "display_title": "4DN DCIC, HMS", "uuid": "828cd4fe-ebb0-4b36-a94a-d2e3a36cc989", "@type": ["Lab", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.828cd4fe-ebb0-4b36-a94a-d2e3a36cc989"]}}, "award": {"@id": "/awards/1U01CA200059-01/", "@type": ["Award", "Item"], "uuid": "b0b9c607-f8b4-4f02-93f4-9895b461334b", "status": "current", "display_title": "4D NUCLEOME NETWORK DATA COORDINATION AND INTEGRATION CENTER - PHASE I", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "options": {"filetype": "html", "collapsible": false, "default_open": true}, "uuid": "f963ca27-1f3a-4f88-a9d9-96d1dcdb4d82", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.owner", "userid.986b362f-4eb6-4a9c-8173-3ab267307e3a"]}}, "location": "tab:processed_files"}, {"content": {"filetype": "md", "title": "Source files", "name": "resources.data-analysis.repli-seq-processing-pipeline.source", "@id": "/static-sections/ac055847-7b66-48d4-8778-90d67226c13f/", "@type": ["StaticSection", "UserContent", "Item"], "content_as_html": "

The pipeline components are pre-installed in a publicly\navailable Docker image (4dndcic/4dn-repliseq:v16.1) on\nDocker Hub. The source code for the Docker image and pipeline\n description in Common Workflow Language (CWL) can be found on\n GitHub.

\n
    \n
  • Latest version (v16.1)
      \n
    • Workflow metadata : https://data.4dnucleome.org/workflows/622bdf75-2dd1-457f-ad78-d4cd128f8f5b/
      • \n
    • CWL : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v16.1/cwl
      • \n
    • Docker : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v16.1
      • \n
    \n
    • \n
  • Older versions
    • \n
  • v16
      \n
    • Workflow metadata : https://data.4dnucleome.org/workflows/2a6807f1-93db-4c7b-b148-672534193974/
      • \n
    • CWL : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v16/cwl
      • \n
    • Docker : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v16
      • \n
    \n
    • \n
  • v14
      \n
    • Workflow metadata : https://data.4dnucleome.org/workflows/4459a4d8-1bd8-4b6a-b2cc-2506f4270a34/
      • \n
    • CWL : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v14/cwl
      • \n
    • Docker : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v14
      • \n
    \n
    • \n
  • v13.1
      \n
    • Workflow metadata : https://data.4dnucleome.org/workflows/146da22a-502d-4500-bf57-a7cf0b4b2364/
      • \n
    • CWL : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v13.1/cwl
      • \n
    • Docker : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v13.1
      • \n
    \n
    • \n
", "status": "released", "display_title": "Source files", "content": "The pipeline components are pre-installed in a publicly\navailable Docker image (`4dndcic/4dn-repliseq:v16.1`) on\nDocker Hub. The source code for the Docker image and pipeline\n description in Common Workflow Language (CWL) can be found on\n GitHub.\n\n* Latest version (v16.1)\n * Workflow metadata : https://data.4dnucleome.org/workflows/622bdf75-2dd1-457f-ad78-d4cd128f8f5b/\n * CWL : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v16.1/cwl\n * Docker : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v16.1\n* Older versions\n * v16\n * Workflow metadata : https://data.4dnucleome.org/workflows/2a6807f1-93db-4c7b-b148-672534193974/\n * CWL : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v16/cwl\n * Docker : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v16\n * v14\n * Workflow metadata : https://data.4dnucleome.org/workflows/4459a4d8-1bd8-4b6a-b2cc-2506f4270a34/\n * CWL : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v14/cwl\n * Docker : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v14\n * v13.1\n * Workflow metadata : https://data.4dnucleome.org/workflows/146da22a-502d-4500-bf57-a7cf0b4b2364/\n * CWL : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v13.1/cwl\n * Docker : https://github.com/4dn-dcic/docker-4dn-repliseq/tree/v13.1", "lab": {"status": "current", "@id": "/labs/4dn-dcic-lab/", "display_title": "4DN DCIC, HMS", "uuid": "828cd4fe-ebb0-4b36-a94a-d2e3a36cc989", "@type": ["Lab", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.828cd4fe-ebb0-4b36-a94a-d2e3a36cc989"]}}, "award": {"@id": "/awards/1U01CA200059-01/", "@type": ["Award", "Item"], "uuid": "b0b9c607-f8b4-4f02-93f4-9895b461334b", "status": "current", "display_title": "4D NUCLEOME NETWORK DATA COORDINATION AND INTEGRATION CENTER - PHASE I", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "options": {"filetype": "md", "collapsible": false, "default_open": true, "convert_ext_links": true}, "uuid": "ac055847-7b66-48d4-8778-90d67226c13f", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.owner", "userid.986b362f-4eb6-4a9c-8173-3ab267307e3a"]}}, "location": "tab:data_processing"}, {"content": {"filetype": "html", "title": "Assay Description", "name": "item-page-headers.ExperimentType.2-stage-repli-seq", "@id": "/static-sections/246c2d7b-9922-4763-9b44-76b2648e57db/", "@type": ["StaticSection", "UserContent", "Item"], "content_as_html": "

\n
\n\n\n\n
\n2-stage or E/L Repli-seq\n

\n

\nDNA replication occurs during the S phase of the cell cycle. \nIn human cells, this process typically lasts for 8\u201310 h. \nDifferent regions of the genome replicate at different times \nduring S phase, following a defined RT program. E/L Repli-seq\n generates data enabling the study of RT at the genome-wide \nlevel, in a sequence-specific manner. The procedure starts \nwith cultured cells that are pulse-labeled with BrdU to label \nnascent DNA. Cells are then fixed and sorted by flow cytometry\n on the basis of their DNA content. DNA from early S-phase and\n late S-phase cells is purified and fragmented. Library \nconstruction and BrdU IP are performed in parallel; adaptors \nare ligated to the purified DNA; next, the BrdU-labeled DNA is \nimmunoprecipitated; and finally, immunoprecipitated DNA is \nindexed. Indexed and pooled libraries are subsequently \nsequenced. Analysis of the sequencing data starts with quality\n control, mapping of reads to the reference genome and \ncalculation of the base 2 log ratio of normalized coverage from\n the early S fraction to the normalized coverage from the late\n S fraction in each window (log2 ratio E/L). Data sets to be \ncompared are then quantile-normalized and Loess-smoothed, \ngenerating a bedGraph file, which can be used for direct \nvisualization in a genome browser \n(e.g. http://www.replicationdomain.org)\n or for further analysis.\n

\n

\nImage source: Marchal et. al. Nature Protocols 2018, Figure 1
", "status": "released", "display_title": "Assay Description", "content": "
\n
\n\n\n\n
\n2-stage or E/L Repli-seq\n

\n

\nDNA replication occurs during the S phase of the cell cycle. \nIn human cells, this process typically lasts for 8\u201310 h. \nDifferent regions of the genome replicate at different times \nduring S phase, following a defined RT program. E/L Repli-seq\n generates data enabling the study of RT at the genome-wide \nlevel, in a sequence-specific manner. The procedure starts \nwith cultured cells that are pulse-labeled with BrdU to label \nnascent DNA. Cells are then fixed and sorted by flow cytometry\n on the basis of their DNA content. DNA from early S-phase and\n late S-phase cells is purified and fragmented. Library \nconstruction and BrdU IP are performed in parallel; adaptors \nare ligated to the purified DNA; next, the BrdU-labeled DNA is \nimmunoprecipitated; and finally, immunoprecipitated DNA is \nindexed. Indexed and pooled libraries are subsequently \nsequenced. Analysis of the sequencing data starts with quality\n control, mapping of reads to the reference genome and \ncalculation of the base 2 log ratio of normalized coverage from\n the early S fraction to the normalized coverage from the late\n S fraction in each window (log2 ratio E/L). Data sets to be \ncompared are then quantile-normalized and Loess-smoothed, \ngenerating a bedGraph file, which can be used for direct \nvisualization in a genome browser \n(e.g. http://www.replicationdomain.org)\n or for further analysis.\n

\n

\nImage source: Marchal et. al. Nature Protocols 2018, Figure 1", "lab": {"status": "current", "@id": "/labs/4dn-dcic-lab/", "display_title": "4DN DCIC, HMS", "uuid": "828cd4fe-ebb0-4b36-a94a-d2e3a36cc989", "@type": ["Lab", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.828cd4fe-ebb0-4b36-a94a-d2e3a36cc989"]}}, "award": {"@id": "/awards/1U01CA200059-01/", "@type": ["Award", "Item"], "uuid": "b0b9c607-f8b4-4f02-93f4-9895b461334b", "status": "current", "display_title": "4D NUCLEOME NETWORK DATA COORDINATION AND INTEGRATION CENTER - PHASE I", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "options": {"filetype": "html", "collapsible": false, "default_open": true}, "uuid": "246c2d7b-9922-4763-9b44-76b2648e57db", "contributing_labs": [{"status": "current", "@id": "/labs/david-gilbert-lab/", "display_title": "David Gilbert, SDBRI", "uuid": "6423b207-8176-4f06-a127-951b98d6a53a", "@type": ["Lab", "Item"], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.6423b207-8176-4f06-a127-951b98d6a53a"]}}], "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.owner", "userid.e2324f87-0625-4bbc-803b-d47677aebe08"]}}, "location": "tab:overview"}], "controlled_term": {"display_title": "2-stage Repli-seq", "@type": ["OntologyTerm", "Item"], "term_url": "http://www.ebi.ac.uk/efo/EFO_0009969", "status": "released", "preferred_name": "2-stage Repli-seq", "term_id": "EFO:0009969", "term_name": "2-stage Repli-seq", "@id": "/ontology-terms/EFO:0009969/", "uuid": "30c3ceea-62ec-4588-ae30-90fc330748c7", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "experiment_name": "2-stage-repli-seq", "current_pipeline": "RepliSeq_Pipeline_v16.1_step1", "valid_item_types": ["ExperimentRepliseq"], "accepted_pipelines": ["RepliSeq_Pipeline_v13.1_step1", "RepliSeq_Pipeline_v14_step1", "RepliSeq_Pipeline_v16_step1"], "experiment_category": "Sequencing", "assay_classification": "Linear DNA Enrichment", "assay_subclass_short": "Replication timing", "assay_subclassification": "Replication Timing", "@id": "/experiment-types/2-stage-repli-seq/", "@type": ["ExperimentType", "Item"], "uuid": "23e234e7-d59e-4c40-ae42-7a7d5339fa76", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}, "display_title": "2-stage Repli-seq", "external_references": [], "@context": "/terms/", "aggregated-items": {}, "validation-errors": []}