![](\"https://s3.amazonaws.com/4dn-dcic-public/static-pages/repliseqpipelinev16.1.png\")
\n\n\n\nThe 4DN Repli-seq data processing pipeline includes read clipping, alignment, filtering, and aggregation. Downstream normalization, smoothing and replicate merging steps will be implemented in the near future.
\n\n\nAdaptor sequences are clipped from repli-seq reads using cutadapt version 1.14. Specifically, we run:
\ncutadapt -q 0 -O 1 -m 0 -a <adaptor> <fastq>\n
AGATCGGAAGAGCACACGTCTG is used as adaptor sequence.
Clipped repli-seq reads are mapped to the GRCh38 (human) or mm10 (mouse) reference genome using bwa version 0.7.15. Specifically, we run bwa mem with default options:
\nbwa mem <genome_index> <fastq1> <fastq2>\n
For filtering valid Repli-seq alignments, we use samtools. \nSpecifically, the filtering workflow consists of the following\n steps:
samtools view command with -q 20 was used to skip alignments with MAPQ smaller than 20.samtools sort command was used to sort alignments by genomic coordinates.samtools rmdup command was used to remove duplicate alignments.Filtered reads were aggregated for each 5kb window using bedtools coverage. Specifically, the following command was used:
\nbedtools coverage -counts -sorted -a <BINFILE> -b <INPUT_BAM>\n
Output is provided in both gzipped bedgraph and bigwig formats and can be viewed using HiGlass.
As of v16.1, the pipeline output includes a raw counts file in addition to the default scaled counts (RPKM).
| File Type | \nFile Format | \nDescription | \n
|---|---|---|
| Alignment | \n.bam | \nFiltered alignments of raw reads to the appropriate reference are available in .bam format. These are generated separately for each replicate experiment in an experiment set. | \n
| Read Counts | \nbedgraph (.bg) | \nContains read counts for each 5kb window after filtering. Replicate experiments are processed separately. These will often have 2 associated files with them - a bedgraph index (.bedGraph.gz.px2) and a bigwig (.bw) file. The bigwig file can be visualized as a 1D track in HiGlass. | \n
| File Type | \nFile Format | \nDescription | \n
|---|---|---|
| Alignment | \n.bam | \nFiltered alignments of raw reads to the appropriate reference are available in .bam format. These are generated separately for each replicate experiment in an experiment set. | \n
| Read Counts | \nbedgraph (.bg) | \nContains read counts for each 5kb window after filtering. Replicate experiments are processed separately. These will often have 2 associated files with them - a bedgraph index (.bedGraph.gz.px2) and a bigwig (.bw) file. The bigwig file can be visualized as a 1D track in HiGlass. | \n
The pipeline components are pre-installed in a publicly\navailable Docker image (4dndcic/4dn-repliseq:v16.1) on\nDocker Hub. The source code for the Docker image and pipeline\n description in Common Workflow Language (CWL) can be found on\n GitHub.