{"lab": {"@id": "/labs/jennifer-cremins-lab/", "@type": ["Lab", "Item"], "status": "current", "title": "Jennifer Cremins, UPENN", "uuid": "b18699f9-e3e9-44e2-8070-d5b044efc09e", "correspondence": [{"contact_email": "amNyZW1pbnNAc2Vhcy51cGVubi5lZHU=", "@id": "/users/8773d50c-1716-4153-9a18-d0f5ff2aa5ee/", "display_title": "Jennifer Phillips-Cremins"}], "display_title": "Jennifer Cremins, UPENN", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin", "role.lab_submitter", "submits_for.b18699f9-e3e9-44e2-8070-d5b044efc09e"]}}, "award": {"name": "1U01DK127405-01", "display_title": "ENGINEERING AND IMAGING 3D GENOME STRUCTURE-FUNCTION DYNAMICS ACROSS TIME SCALES", "uuid": "b3046311-087c-4141-8e98-a099b96ac6cd", "project": "4DN", "status": "current", "center_title": "Phillips-Cremins", "@type": ["Award", "Item"], "@id": "/awards/1U01DK127405-01/", "description": "RT-CDF:The mammalian genome folds into tens of thousands of long-range looping interactions. A critical unknown is whether and how chromatin loops control gene expression, and a major unresolved question is how the temporal progression of loops relates to transcription dynamics. One major barrier to answering this question is that loops change on a range of timescales, necessitating the use of tools and model systems amenable to tracking and engineering loops longitudinally and in real time on both short and long timing. Here, we propose to develop and apply new engineering and imaging tools to measure, induce, and perturb loops with precise temporal control in three different biological systems spanning minutes, hours, and weeks. At the shortest timescale (minutes, Aim 1), we will examine loop dynamics in human induced pluripotent stem cell-derived neurons in response to electrical stimulation, revealing how interaction frequency is functionally connected to transcriptional bursting of immediate early and secondary response genes. On the timescale of hours (Aim 3), we will elucidate how the architectural protein YY1 connects enhancer-promoter loops that re-assemble upon the exit from mitosis by erythroid cells. On the timescale of weeks (Aim 2), we will use a cellular \u201cTime Machine\u201d to longitudinally track the rare cells that undergo cellular reprogramming, allowing us to dissect the functionality of loop formation and dissolution with single-cell and subcellular resolution during the reprogramming of somatic cells to pluripotency and transition of melanoma cancer cells to a resistant phenotype. Our team consists of a highly productive and collaborative set of junior and senior investigators with complementary expertise and overlapping interests, including Dr. Gerd Blobel (epigenetics, mitosis, loop engineering), Dr. Eric Joyce (Oligopaints imaging), Dr. Bomyi Lim (nascent transcript live cell imaging), Dr. Jennifer Phillips-Cremins (chromatin architecture, loop engineering, neurobiology), Dr. Stanley Qi (CRISPR genome engineering, live cell imaging), and Dr. Arjun Raj (single cell genomics, RNA imaging, reprogramming). We will develop and apply live and fixed cell imaging techniques for chromatin contacts, and in the same cells image nascent transcription. We will build a cadre of synthetic architectural proteins to engineer loops in a time-dependent inducible manner. Successful application of our engineering and imaging tools across biological systems will yield a comprehensive and rigorous assessment of the cause-and-effect relationship between loops and distinct biological phenotypes across timescales.", "pi": {"error": "no view permissions"}, "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}, "status": "released", "aliases": ["cremins-lab:mod_80kb_del"], "guide_rnas": ["TCCGCAGTGAAGAAGCAACA", "ACCATCCGGACCAAACGGGG", "ACTCCGGTGAGGTAGCAAGG", "AATATGATCCATGTACTACG"], "description": "Deletion of 80 kb region at hg19, chrX: 148,551,953-148,636,657 including an early/late replication boundary", "date_created": "2021-01-22T00:19:23.342235+00:00", "submitted_by": {"error": "no view permissions"}, "last_modified": {"modified_by": {"error": "no view permissions"}, "date_modified": "2021-02-02T22:34:17.686410+00:00"}, "target_of_mod": [{"@id": "/bio-features/4ecbdbe9-0949-426a-bc2d-1dfa8bfce44c/", "display_title": "80KB IDS deletion", "uuid": "4ecbdbe9-0949-426a-bc2d-1dfa8bfce44c", "@type": ["BioFeature", "Item"], "status": "released", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}}], "genomic_change": "deletion", "public_release": "2021-02-02", "schema_version": "2", "project_release": "2021-02-02", "modification_type": "Crispr", "@id": "/modifications/b58569ad-9d0a-4f3b-bfcc-e5a2d916e061/", "@type": ["Modification", "Item"], "uuid": "b58569ad-9d0a-4f3b-bfcc-e5a2d916e061", "principals_allowed": {"view": ["system.Everyone"], "edit": ["group.admin"]}, "display_title": "Crispr deletion for 80KB IDS deletion", "external_references": [], "modification_name": "Crispr deletion for 80KB IDS deletion", "modification_name_short": "80KB deletion", "@context": "/terms/", "aggregated-items": {}, "validation-errors": []}